IthaID: 129


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 33/34 (GTGGTC>GTC) HGVS Name: HBB:c.102_104del
Hb Name: Hb Korea Protein Info: β 33(B15) Val>0

Context nucleotide sequence:
ATTTTCCCACCCTTAGGCTGCTG [GTGGTC/GTC] TACCCTTGGACCCAGAGGTTCTT (Strand: -)

Also known as:

Comments: Deletion produces the phenotype of dominant beta thalassaemia. The β33 Val (B15) and β34 Val (B16) are essential for the α1 and β1 subunit interactions. It is likely that the deletion of either of the valines in these positions would disrupt the B-helix and prevent α/β dimeric formation and, effectively, functional loss of one half of the β-globin chains. No abnormal haemoglobin was detected on Hb electrophoresis or by the heat denaturation or isopropanol stability tests.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70826
Size: 3 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Korean
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Park SS, Barnetson R, Kim SW, Weatherall DJ, Thein SL, A spontaneous deletion of beta 33/34 Val in exon 2 of the beta globin gene (Hb Korea) produces the phenotype of dominant beta thalassaemia., British journal of haematology, 78(4), 581-2, 1991
  2. Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997
Created on 2010-06-16 16:13:14, Last reviewed on 2021-05-26 12:25:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.