IthaID: 128
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 36 CCT>C-T | HGVS Name: | HBB:c.110del |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCACCCTTAGGCTGCTGGTGGTCTACC [-/C] TTGGACCCAGAGGTTCTTTGAGT (Strand: -)
Also known as: CD 36 (-C)
Comments: Loss of nt C between codons 35 and 36 generates a frameshift with a nonsense codon at codon 60 (TGA) terminating translation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70834 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Malay, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Yang KG, Kutlar F, George E, Wilson JB, Kutlar A, Stoming TA, Gonzalez-Redondo JM, Huisman TH, Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major., British journal of haematology, 72(1), 73-80, 1989
- Huang H, Xu L, Lin N, He D, Li Y, Guo D, Wang L, Wang Y, Zhen L, Xu J, Lin Y, Molecular spectrum of β-thalassemia in Fujian Province, Southeastern China., Hemoglobin , 37(4), 343-50, 2013
Created on 2010-06-16 16:13:14,
Last reviewed on 2023-02-23 11:38:12 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.