IthaID: 113


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-110 G>A HGVS Name: HBB:c.93-21G>A
Hb Name: N/A Protein Info: β nt 252 G>A

Context nucleotide sequence:
TAGGCACTGACTCTCTCTGCCTATT [G>A] GTCTATTTTCCCACCCTTAGGCTGC (Strand: -)

Also known as:

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70796
Size: 1 bp
Located at: β
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Cryptic splice site (mRNA Processing)
Ethnic Origin: Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Frequencies

Publications / Origin

  1. Spritz RA, Jagadeeswaran P, Choudary PV, Biro PA, Elder JT, deRiel JK, Manley JL, Gefter ML, Forget BG, Weissman SM, Base substitution in an intervening sequence of a beta+-thalassemic human globin gene., Proceedings of the National Academy of Sciences of the United States of America, 78(4), 2455-9, 1981
  2. Westaway D, Williamson R, An intron nucleotide sequence variant in a cloned beta +-thalassaemia globin gene., Nucleic acids research, 9(8), 1777-88, 1981
Created on 2010-06-16 16:13:14, Last reviewed on 2021-01-20 16:34:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.