IthaID: 113
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I-110 G>A | HGVS Name: | HBB:c.93-21G>A |
| Hb Name: | N/A | Protein Info: | β nt 252 G>A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TAGGCACTGACTCTCTCTGCCTATT [G>A] GTCTATTTTCCCACCCTTAGGCTGC (Strand: -)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70796 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing) |
| Ethnic Origin: | Mediterranean, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Spritz RA, Jagadeeswaran P, Choudary PV, Biro PA, Elder JT, deRiel JK, Manley JL, Gefter ML, Forget BG, Weissman SM, Base substitution in an intervening sequence of a beta+-thalassemic human globin gene., Proceedings of the National Academy of Sciences of the United States of America, 78(4), 2455-9, 1981
- Westaway D, Williamson R, An intron nucleotide sequence variant in a cloned beta +-thalassaemia globin gene., Nucleic acids research, 9(8), 1777-88, 1981
- Guangkuan Zeng, Yiyuan Ge, Xiaomin Ma, Xiaohua Yu, Bairu Lai, Yuwei Liao, Lili Liu, Yanbin Cao, Yanqing Zeng, Yuchan Huang, Jianlian Liang, Liye Yang, Analysis of five Chinese individuals with rare thalassemia mutation HBB: c.93-21G＞A, Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 41(10), 1171-75, 2024
Created on 2010-06-16 16:13:14,
Last reviewed on 2024-10-14 12:00:14 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.