IthaID: 111
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I-6 (T>C) | HGVS Name: | HBB:c.92+6T>C |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGTGGTGAGGCCCTGGGCAGGTTGG [T/C] ATCAAGGTTACAAGACAGGTTTAAG (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70692 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
| Ethnic Origin: | Mediterranean, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Orkin SH, Kazazian HH, Antonarakis SE, Goff SC, Boehm CD, Sexton JP, Waber PG, Giardina PJ, Linkage of beta-thalassaemia mutations and beta-globin gene polymorphisms with DNA polymorphisms in human beta-globin gene cluster., Nature, 296(5858), 627-31, 1982
- Tamagnini GP, Lopes MC, Castanheira ME, Wainscoat JS, Wood WG, Beta + thalassemia--Portuguese type: clinical, haematological and molecular studies of a newly defined form of beta thalassaemia., British journal of haematology, 54(2), 189-200, 1983
- Chen B, Huang P, Yi S, Chen Q, Tang Y, Zhang Q, He S, First Detection of a Splice Site β-Thalassemia Mutation, IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in a Chinese Family., Hemoglobin, 39(3), 207-8, 2015
Created on 2010-06-16 16:13:14,
Last reviewed on 2022-06-03 13:37:55 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.