IthaID: 1100
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 93-97 (-15 bp) | HGVS Name: | HBB:c.280_294delTGTGACAAGCTGCAC |
| Hb Name: | Hb Gun Hill | Hb GH | Protein Info: | β 91(F7) - 95(FG2) Leu-His-Cys-Asp-Lys->0 |
Context nucleotide sequence:
TTTGCCACACTGAGTGAGCTGCAC [-/TGTGACAAGCTGCAC] GTGGATCCTGAGAACTTCAGGGTGA (Strand: -)
Also known as:
Comments: Found in a heterozygous state in two members of a family with German and English ancestry, and presenting with mild compensated haemolysis. Found as a heterozygote in an assymptomatic black female living in Alabama; her parents and siblings did not carry the variant. The deleted residues occur in a region involved in heme-globin binding. The β-chains of Hb Gun Hill lack heme groups. Reported in literature as HBB:c.274_288del (α2β2 codons 91-95 deleted), which does not follow the HGVS Sequence Variant Nomeclature recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71004 |
| Size: | 15 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | English, German, African |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Bradley TB, Wohl RC, Rieder RF, Hemoglobin Gun Hill: deletion of five amino acid residues and impaired heme-globin binding., Science (New York, N.Y.), 157(796), 1581-3, 1967
- Rieder RF, Synthesis of hemoglobin Gun Hill: increased synthesis of the heme-free beta-GH globin chain and subunit exchange with a free alpha-chain pool., J. Clin. Invest., 50(2), 388-400, 1971
- Murari J, Smith LL, Wilson JB, Schneider RG, Huisman TH, Some properties of hemoglobin Gun Hill., Hemoglobin, 1(3), 267-82, 1977