IthaID: 1087
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 87 (-ACA) | HGVS Name: | HBB:c.262_264delACA |
| Hb Name: | Hb Tours | Protein Info: | β 87(F3) Thr->0 |
Context nucleotide sequence:
GGACAACCTCAAGGGCACCTTTGCC [-/ACA] CTGAGTGAGCTGCACTGTGACAAGC (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70986 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | French |
| Molecular mechanism: | Altered interaction with HbS polymer |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Wajcman H, Labie D, Schapira G, Two new hemoglobin variants with deletion. Hemoglobin tours: Thr 8 7 (F 3 ) deleted and hemoglobin St Antoine: Gly-Leu 74-75 (E 18-19 deleted. Consequences for oxygen affinity and protein stability., Biochimica et biophysica acta, 295(2), 495-504, 1973
Created on 2010-06-16 16:13:16,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.