IthaID: 107


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-5 (G>C) HGVS Name: HBB:c.92+5G>C
Hb Name: N/A Protein Info: β nt 147 G>C

Context nucleotide sequence:
TGGTGGTGAGGCCCTGGGCAGGTTG [A/C/G/T] TATCAAGGTTACAAGACAGGTTTAA (Strand: -)

Also known as:

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70691
Size: 1 bp
Located at: β
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Asian Indian, SE Asian, Melanesian, Pakistani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Frequencies

Publications / Origin

  1. Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983
  2. Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984
  3. Hill AV, Bowden DK, O'Shaughnessy DF, Weatherall DJ, Clegg JB, Beta thalassemia in Melanesia: association with malaria and characterization of a common variant (IVS-1 nt 5 G----C)., Blood, 72(1), 9-14, 1988
  4. Kulozik AE, Bail S, Kar BC, Serjeant BE, Serjeant GE, Sickle cell-beta+ thalassaemia in Orissa State, India., British journal of haematology, 77(2), 215-20, 1991
  5. Divoky V, Bissé E, Wilson JB, Gu LH, Wieland H, Heinrichs I, Prior JF, Huisman TH, Heterozygosity for the IVS-I-5 (G-->C) mutation with a G-->A change at codon 18 (Val-->Met; Hb Baden) in cis and a T-->G mutation at codon 126 (Val-->Gly; Hb Dhonburi) in trans resulting in a thalassemia intermedia., Biochimica et biophysica acta, 1180(2), 173-9, 1992
  6. Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016
Created on 2010-06-16 16:13:14, Last reviewed on 2016-09-02 14:25:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.