IthaID: 107

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGGTGGTGAGGCCCTGGGCAGGTTG [G/C] TATCAAGGTTACAAGACAGGTTTAA (Strand: -)

Comments: The G>C substitution at the 5th base of IVS 1 disrupts normal splicing. The variant activates three cryptic donor sites that lead to the production of three different abnormally spliced RNAs. The normally spliced RNA is also produced (in vitro experiments).

Heterozygous records (preview in IthaPhen)

1. Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983
2. Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984
3. Hill AV, Bowden DK, O'Shaughnessy DF, Weatherall DJ, Clegg JB, Beta thalassemia in Melanesia: association with malaria and characterization of a common variant (IVS-1 nt 5 G----C)., Blood, 72(1), 9-14, 1988
4. Kulozik AE, Bail S, Kar BC, Serjeant BE, Serjeant GE, Sickle cell-beta+ thalassaemia in Orissa State, India., British journal of haematology, 77(2), 215-20, 1991
5. Divoky V, Bissé E, Wilson JB, Gu LH, Wieland H, Heinrichs I, Prior JF, Huisman TH, Heterozygosity for the IVS-I-5 (G-->C) mutation with a G-->A change at codon 18 (Val-->Met; Hb Baden) in cis and a T-->G mutation at codon 126 (Val-->Gly; Hb Dhonburi) in trans resulting in a thalassemia intermedia., Biochimica et biophysica acta, 1180(2), 173-9, 1992
6. Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016