IthaID: 1029
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 69 (+GCTCGG) | HGVS Name: | HBB:c.204_209dupGCTCGG |
Hb Name: | Hb Nishinomiya | Protein Info: | β 69(E13) Gly->0 AND Gly-Leu-Gly- inserted between 68(E12) and 70(E14) of β |
Context nucleotide sequence:
AGGCTCATGGCAAGAAAGTGCTCGG [-/GCTCGG] TGCCTTTAGTGATGGCCTGGCTCAC (Strand: -)
Also known as:
Comments: Found in a patient with spherocytic hemolysis. This mutation resulted in the insertion of two amino acid residues β69GGT(Gly)>GGG(Gly)CTC(Leu)GGT(Gly). Insertion of Leu-Gly between positions 69(E13) and 70(E14) of the chain alters the amino acid residues of helix E in and around the heme pocket. Amino acid substitutions around position 70-73(E14-17) of the chain are likely to alter stability and oxygen affinity.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70928 |
Size: | 5 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Japanese |
Molecular mechanism: | Altered secondary structure |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Naito Y, Takahashi T, Matsunashi T, Harano K, Harano T, Hb Nishinomiya [Leu-Gly-inserted between codons 69(E13) and 70(E14) of beta]: a novel unstable hemoglobin with reduced oxygen affinity found in a patient with spherocytic hemolysis., International journal of hematology, 76(2), 146-8, 2002
Created on 2010-06-16 16:13:16,
Last reviewed on 2019-11-13 10:02:17 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:16 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-13 10:02:17 | The IthaGenes Curation Team | Reviewed. HGVS name and Location corrected. Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02