IthaID: 1029


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 69 (+GCTCGG) HGVS Name: HBB:c.204_209dupGCTCGG
Hb Name: Hb Nishinomiya Protein Info: β 69(E13) Gly->0 AND Gly-Leu-Gly- inserted between 68(E12) and 70(E14) of β

Context nucleotide sequence:
AGGCTCATGGCAAGAAAGTGCTCGG [-/GCTCGG] TGCCTTTAGTGATGGCCTGGCTCAC (Strand: -)

Also known as:

Comments: Found in a patient with spherocytic hemolysis. This mutation resulted in the insertion of two amino acid residues β69GGT(Gly)>GGG(Gly)CTC(Leu)GGT(Gly). Insertion of Leu-Gly between positions 69(E13) and 70(E14) of the chain alters the amino acid residues of helix E in and around the heme pocket. Amino acid substitutions around position 70-73(E14-17) of the chain are likely to alter stability and oxygen affinity.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70928
Size: 5 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Japanese
Molecular mechanism: Altered secondary structure
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Naito Y, Takahashi T, Matsunashi T, Harano K, Harano T, Hb Nishinomiya [Leu-Gly-inserted between codons 69(E13) and 70(E14) of beta]: a novel unstable hemoglobin with reduced oxygen affinity found in a patient with spherocytic hemolysis., International journal of hematology, 76(2), 146-8, 2002
Created on 2010-06-16 16:13:16, Last reviewed on 2019-11-13 10:02:17 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.