IthaID: 1


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -190 (G>A) HGVS Name: HBB:c.-240G>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGGGCCAAGAGATATATCTTA [G>A] AGGGAGGGCTGAGGGTTTGA (Strand: -)

Also known as:

Comments: Found in a Moroccan family, the mutation causes a β-thalassaemia intermedia in compound heterozygosity with a β0-thalassaemia mutation, and exhibits a silent phenotype in a heterozygous carrier.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70355
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Moroccan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Frequencies

Publications / Origin

  1. Agouti I, Bennani M, Nezri M, Levy N, Badens C, Beta-thalassemia intermedia due to two novel mutations in the promoter region of the beta-globin gene., Eur. J. Haematol. , 80(4), 346-50, 2008
Created on 2010-06-16 16:13:14, Last reviewed on 2020-01-31 08:45:43 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.